| Sequence ID | >WENV170013154 |
| Genome ID | ATLU01000087 |
| Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
| Species | |
| Start position on genome | 31304 |
| End posion on genome | 31230 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
accgcgcagt |
| tRNA gene sequence |
TCCGGCGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGTCGTAGGTTCGATCC |
| Downstream region at tRNA end position |
gagatttcaa |
| Secondary structure (Cloverleaf model) | >WENV170013154 Asn GTT
t GCCA gagatttcaa
T - A
C - G
C - G
G - C
G - C
C - G
G - C C T
T C A T C C A
G A A | | | | | G
C C T C G G T A G G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
T - A
T - A
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |