Sequence ID | >WENV170013155 |
Genome ID | ATLU01000090 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1276 |
End posion on genome | 1201 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cacccaaagt |
tRNA gene sequence |
GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTAGGTCCGCGGTTCGAGT |
Downstream region at tRNA end position |
ttttatcaat |
Secondary structure (Cloverleaf model) | >WENV170013155 Thr TGT t ACCA ttttatcaat G - C C - G C - G C - G C - G T + G A - T T G T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |