Sequence ID | >WENV170013158 |
Genome ID | ATLU01000109 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 23582 |
End posion on genome | 23496 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttccctcat |
tRNA gene sequence |
GCCGGGGTGGTGAAATTGGTAGACACAGGGGATTCAAAATCCCCCGGGAGCAATCCCTTG |
Downstream region at tRNA end position |
tatacaaatc |
Secondary structure (Cloverleaf model) | >WENV170013158 Leu CAA t ACCA tatacaaatc G + T C - G C - G G - C G + T G - C G - C T G T C A G C C A T A A G | | | | | G T A G T G G T C G G C G | | | T T G A C A C T A G A CGGGAGCAATCCCTT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |