| Sequence ID | >WENV170013160 |
| Genome ID | ATLU01000116 |
| Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
| Species | |
| Start position on genome | 399 |
| End posion on genome | 315 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
cgggcttcgt |
| tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCCGCCTTCGGA |
| Downstream region at tRNA end position |
ctaaatttgt |
| Secondary structure (Cloverleaf model) | >WENV170013160 Tyr GTA
t ACCA ctaaatttgt
G - C
G - C
A - T
G - C
G - C
G - C
G - C T A
T C C T C C A
T G A T | | | | | G
G G C C C G G A G G C
G | | | T T
C A G G G
C A A A CGGCTCCGCCTTC
T - A
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |