Sequence ID | >WENV170013165 |
Genome ID | ATLU01000126 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2639 |
End posion on genome | 2550 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gggctattaa |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGCCGAACGGGACTGATTCGAAATCAGTTGACCCTTTGCGGGGT |
Downstream region at tRNA end position |
cttaatcgat |
Secondary structure (Cloverleaf model) | >WENV170013165 Ser CGA a GCCA cttaatcgat G - C G - C A - T G - C A - T G - C G - C T A T G T C C C A T G A G | | | | | G G G G C C C A G G G C G | | | T T C A C G G C G A G TGACCCTTTGCGGGGTCC A - T C - G T - A G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |