Sequence ID | >WENV170013167 |
Genome ID | ATLU01000140 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 8136 |
End posion on genome | 8051 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acttgtcggg |
tRNA gene sequence |
GCCCGCGTGGTGGAATGGTAGACACAAGAGACTTAAAATCTCTGGGCCGAGAGGCCGTGC |
Downstream region at tRNA end position |
ggtaattctg |
Secondary structure (Cloverleaf model) | >WENV170013167 Leu TAA g ACCA ggtaattctg G + T C - G C - G C - G G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G A GGGCCGAGAGGCCGT A - T G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |