Sequence ID | >WENV170013169 |
Genome ID | ATLU01000153 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 15004 |
End posion on genome | 14920 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcccctgcat |
tRNA gene sequence |
GCCGATGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGCAAGCCGTGCC |
Downstream region at tRNA end position |
tataagagaa |
Secondary structure (Cloverleaf model) | >WENV170013169 Leu GAG t ACCA tataagagaa G - C C - G C - G G - C A - T T - A G - C T A T C G G C C A T A A G | | | | | A T A G T G G C C G G C G | | | T T G A C A C T A G G TGGCGCAAGCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |