Sequence ID | >WENV170013173 |
Genome ID | ATLU01000190 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 15510 |
End posion on genome | 15435 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aattttttac |
tRNA gene sequence |
AGGCCAGTGGCTCAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
ttatttaaag |
Secondary structure (Cloverleaf model) | >WENV170013173 Trp CCA c GCCA ttatttaaag A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A T A A G | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |