Sequence ID | >WENV170013174 |
Genome ID | ATLU01000192 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 15083 |
End posion on genome | 15010 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaaatactgg |
tRNA gene sequence |
GCGGGCGTTGTGTAATGGTAAGACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gaaattattt |
Secondary structure (Cloverleaf model) | >WENV170013174 Gly TCC g TCCA gaaattattt G - C C - G G - C G - C G - C C - G G - C T T T C G C C C A A A T | | | | | G T T G T G G C G G G C G | | | T T G A G A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |