Sequence ID | >WENV170013175 |
Genome ID | ATLU01000195 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 14075 |
End posion on genome | 14149 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tccatttagg |
tRNA gene sequence |
GGGCGCGTAGCTCAGCGGGAGAGCACTACCTTCACACGGTAGGGGTCCCTGGTTCGATCC |
Downstream region at tRNA end position |
ataaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170013175 Val CAC g ACCA ataaaatcaa G - C G - C G - C C - G G - C C - G G - C C T T G G A C C A G A A | | | | | G C C T C G C C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |