Sequence ID | >WENV170013181 |
Genome ID | ATLU01000206 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 759 |
End posion on genome | 848 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caacgccctc |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGGAACCGTC |
Downstream region at tRNA end position |
gcccccccca |
Secondary structure (Cloverleaf model) | >WENV170013181 Ser GGA c GCCA gcccccccca G - C G - C A - T C - G A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCGGGGAACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |