Sequence ID | >WENV170013182 |
Genome ID | ATLU01000210 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 12533 |
End posion on genome | 12609 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cccgctttac |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGTGGACTCATAATCCATTGGTCCTAGGTTCGAG |
Downstream region at tRNA end position |
taataaaatc |
Secondary structure (Cloverleaf model) | >WENV170013182 Met CAT c ACCA taataaaatc G - C G - C G - C C - G C - G T - A A - T T G T G A T C C A T G A A | | | | | G T C T C G C T A G G C G | | | | T T G G A G C T T A A TGGTC G + T T - A G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |