Sequence ID | >WENV170013183 |
Genome ID | ATLU01000214 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 8136 |
End posion on genome | 8061 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ccccggtctt |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCGACGGTCTCCAAAACCGTAGGTCCCGGGTTCGAGC |
Downstream region at tRNA end position |
agaccctccc |
Secondary structure (Cloverleaf model) | >WENV170013183 Trp CCA t GCCA agaccctccc A - T G - C G - C G - C G - C T + G A - T C G T G G T C C A T G A A | | + | | G T C T C G C C G G G C G | | | | T T G G A G C T A G AGGTC A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |