Sequence ID | >WENV170013189 |
Genome ID | ATLU01000228 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 12068 |
End posion on genome | 12144 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cgctcagttt |
tRNA gene sequence |
CGGGCGGTGGCGCAGTCTGGTAGCGTGCTTGTCTGGGGGACAAGTGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
aaattgaaaa |
Secondary structure (Cloverleaf model) | >WENV170013189 Pro GGG t ACCA aaattgaaaa C - G G - C G - C G - C C - G G - C G - C T A T T G T C C A T G A G + | | | | A C C G C G G C A G G C T | | | + T T G G C G T G T A G TGGTC C - G T - A T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |