Sequence ID | >WENV170013193 |
Genome ID | ATLU01000262 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 222 |
End posion on genome | 298 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccaaagttaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGTGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
ttttagtaag |
Secondary structure (Cloverleaf model) | >WENV170013193 Arg ACG a GCCA ttttagtaag G - C C - G G - C C - G C - G C - G G - C T A T C T T C C A C G A A | + | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A TGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |