Sequence ID | >WENV170013194 |
Genome ID | ATLU01000297 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1419 |
End posion on genome | 1495 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gagattgcat |
tRNA gene sequence |
GCGGGTGTAGCTCAATTGGCTAGAGCATCTGCCTTCCAAGCAGAGGGTTGTGAGTTCGAG |
Downstream region at tRNA end position |
tttcaaaagc |
Secondary structure (Cloverleaf model) | >WENV170013194 Gly TCC t TCCA tttcaaaagc G - C C - G G - C G - C G - C T - A G - C T G T T A C T C A T A A A + | | | | G T C T C G G T G A G C G | | | | T T G G A G C C T A A GGGTT T - A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |