Sequence ID | >WENV170013199 |
Genome ID | ATLU01000306 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1161 |
End posion on genome | 1087 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cgatgaagat |
tRNA gene sequence |
GCTGTGGTAGCTCAGTGGTAGAGCGCGTCATTGGTAATGACGAGGTCGGGAGTTCAATCC |
Downstream region at tRNA end position |
ttaactttta |
Secondary structure (Cloverleaf model) | >WENV170013199 Thr GGT t ACCA ttaactttta G - C C - G T - A G - C T - A G - C G + T C T T C C C T C A G A A | | | | | A T C T C G G G G A G C G | | | | T T G G A G C T A G AGGTC C - G G - C T - A C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |