Sequence ID | >WENV170013201 |
Genome ID | ATLU01000323 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 216 |
End posion on genome | 292 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gaaaatccga |
tRNA gene sequence |
CGGGGACTGGCGCAATTGGCTAGCGCACACGCTTTGGGAGCGTGGGGTTGTGAGTTCGAG |
Downstream region at tRNA end position |
ttaagtttct |
Secondary structure (Cloverleaf model) | >WENV170013201 Pro TGG a ACCA ttaagtttct C - G G - C G - C G - C G - C A - T C - G T G T C G C T C A T A A G | + | | | G T C G C G G T G A G C G | | | | T T G G C G C C T A A GGGTT C - G A - T C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |