Sequence ID | >WENV170013202 |
Genome ID | ATLU01000323 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 374 |
End posion on genome | 450 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ccattgttat |
tRNA gene sequence |
GGGTGTATAGCTCAGTTGGTTAGAGCGCACGACTGATAATCGTGAGGTCCCAAGTTCAAC |
Downstream region at tRNA end position |
tttaaaccta |
Secondary structure (Cloverleaf model) | >WENV170013202 Ile GAT t ACCA tttaaaccta G - C G - C G - C T - A G + T T - A A - T T C T G G T T C A T G A A | | | | | A T C T C G C C A A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |