Sequence ID | >WENV170013204 |
Genome ID | ATLU01000371 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1040 |
End posion on genome | 1114 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gccttcccgt |
tRNA gene sequence |
GCCCGGGTAGCTCAGGGGTAGAGCAGTGGATTGAAAATCCTCGTGTCGGTGGTTCGATTC |
Downstream region at tRNA end position |
ttttaccatc |
Secondary structure (Cloverleaf model) | >WENV170013204 Phe GAA t ACCA ttttaccatc G - C C - G C - G C - G G + T G - C G - C T T T C C G C C A G A A | | + | | G G C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C T T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |