Sequence ID | >WENV170013208 |
Genome ID | ATLU01000415 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 976 |
End posion on genome | 900 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aacacagcct |
tRNA gene sequence |
GGGGAATTAGCTCAGTTGGCTAGAGCGCTCGCCTTGCACGCGAGAGGTCAGGAGTTCGAC |
Downstream region at tRNA end position |
ttatttattt |
Secondary structure (Cloverleaf model) | >WENV170013208 Ala TGC t ACCA ttatttattt G - C G - C G + T G - C A - T A - T T - A T C T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C C T A G AGGTC C - G T - A C - G G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |