Sequence ID | >WENV170013209 |
Genome ID | ATLU01000453 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 402 |
End posion on genome | 478 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttgccccagc |
tRNA gene sequence |
GGTCCCTTAGCTCAACCGGATAGAGCATCTGCCTTCTAAGCAGAGGGTTGCAGGTTCGAG |
Downstream region at tRNA end position |
tcgtcatttc |
Secondary structure (Cloverleaf model) | >WENV170013209 Arg TCT c GCCA tcgtcatttc G - C G + T T - A C - G C - G C - G T - A T G T C G T C C A C A A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |