Sequence ID | >WENV170013211 |
Genome ID | ATLU01000476 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2135 |
End posion on genome | 2210 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgacgactga |
tRNA gene sequence |
GCCCGGTTAGCTCAGCGGTAGAGCGGGAGGTTTACATCCTCCGACAGCGGCGGTTCAATC |
Downstream region at tRNA end position |
ataacgcgtc |
Secondary structure (Cloverleaf model) | >WENV170013211 Val TAC a ACCA ataacgcgtc G + T C - G C - G C - G G - C G - C T - A C T T C T G C C A G A A | + | | | A C C T C G G G C G G C G | | | | T T G G A G C T A G GACAGC G - C G - C A - T G - C G - C T T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |