Sequence ID | >WENV170013212 |
Genome ID | ATLU01000476 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2838 |
End posion on genome | 2913 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caaaatttct |
tRNA gene sequence |
GGGGCATTAGCTCATCTGGGAGAGCGCCTGCTTTGCAAGCAGGAGGTGCGGGGTTCGAGT |
Downstream region at tRNA end position |
aatcccttga |
Secondary structure (Cloverleaf model) | >WENV170013212 Ala TGC t ACCA aatcccttga G - C G - C G + T G - C C - G A - T T - A T G T G C C C C A C T A A | | | | | G T C T C G C G G G G C G | | | | T T G G A G C G A G AGGTG C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |