Sequence ID | >WENV170013215 |
Genome ID | ATLU01000508 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 148 |
End posion on genome | 58 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
actatttact |
tRNA gene sequence |
GGAAGGGTGTCTGAGTGGTTGAAAGAGCACGCTTGGAAAGCGTGTGATTGGTTCGCCCAA |
Downstream region at tRNA end position |
gtttttaaaa |
Secondary structure (Cloverleaf model) | >WENV170013215 Ser GGA t TCCA gtttttaaaa G - C G - C A - T A - T G - C G - C G - C T A T T G C T C A T G A G + | | | | G G G T C T G C G A G C G | | | T T T A A G A T G A G TGATTGGTTCGCCCAATCC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |