Sequence ID | >WENV170013216 |
Genome ID | ATLU01000554 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2448 |
End posion on genome | 2364 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttcttgtct |
tRNA gene sequence |
GCCCAGATGGTGGAATTGGTAGACACGCAAGACTTAAAATCTTGTTCCCTCGGGAGTCCG |
Downstream region at tRNA end position |
ttttataaat |
Secondary structure (Cloverleaf model) | >WENV170013216 Leu TAA t ACCA ttttataaat G - C C - G C - G C - G A - T G - C A - T T T T G G C C C A T A A G | | | | | G T G G T G C C G G G C G | | | T T G A C A C T A G G TTCCCTCGGGAGT C - G A - T A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |