Sequence ID | >WENV170013219 |
Genome ID | ATLU01000575 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 3453 |
End posion on genome | 3378 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttaagttttt |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCAGTTCGATC |
Downstream region at tRNA end position |
tctttaagcg |
Secondary structure (Cloverleaf model) | >WENV170013219 Ala TGC t ACCA tctttaagcg G - C G - C G + T G - C C - G T - A A - T C T T T C G T C A C G A A | | | | | G T C T C G A G C A G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |