Sequence ID | >WENV170013220 |
Genome ID | ATLU01000612 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2897 |
End posion on genome | 2982 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gatgccccgt |
tRNA gene sequence |
GCCCGAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGGTAGCAATACCGTGT |
Downstream region at tRNA end position |
gttgaggatt |
Secondary structure (Cloverleaf model) | >WENV170013220 Leu CAA t ACCA gttgaggatt G - C C - G C - G C - G G - C A - T G - C T G T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C A G A CGGTAGCAATACCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |