Sequence ID | >WENV170013221 |
Genome ID | ATLU01000613 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2939 |
End posion on genome | 2863 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cacataacgc |
tRNA gene sequence |
GCTCTGGTAGCTCAGCTGGATAGAGTACCTGACTACGAATCAGGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
cttcttccct |
Secondary structure (Cloverleaf model) | >WENV170013221 Arg ACG c GCCA cttcttccct G - C C - G T - A C - G T - A G - C G - C T A T C C T C C A C G A A | | + | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A GGGTC C - G C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |