Sequence ID | >WENV170013222 |
Genome ID | ATLU01000618 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 988 |
End posion on genome | 905 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaagaaagt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCCTG |
Downstream region at tRNA end position |
ctttcttccc |
Secondary structure (Cloverleaf model) | >WENV170013222 Tyr GTA t ACCA ctttcttccc G - C G - C G - C C - G G - C A - T C - G T T A G G A C C A A C G | | | | | G A G C C G C C T G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |