Sequence ID | >WENV170013225 |
Genome ID | ATLU01000659 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 692 |
End posion on genome | 767 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cccgcctacc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
ttaaatcaac |
Secondary structure (Cloverleaf model) | >WENV170013225 Val TAC c ACCA ttaaatcaac G - C G - C G - C T - A C - G G - C T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |