Sequence ID | >WENV170013229 |
Genome ID | ATLU01000774 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1120 |
End posion on genome | 1044 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ctaatccaaa |
tRNA gene sequence |
GCCCCCGTAGCTCAACTGGATAGAGCAGCGTCGTTCTAAGTCGCGTGTTACAGGTTCGAG |
Downstream region at tRNA end position |
ttaaacaaag |
Secondary structure (Cloverleaf model) | >WENV170013229 Arg TCT a ACCA ttaaacaaag G + T C - G C - G C - G C - G C - G G + T T G T T G T C C A C A A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A GTGTT G - C C - G G - C T T C - G G A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |