Sequence ID | >WENV170013230 |
Genome ID | ATLU01000798 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1083 |
End posion on genome | 1158 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tgactggttt |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCTTCGCTGGCAGCGAAGAGGTCAGGAGTTCGATC |
Downstream region at tRNA end position |
aaccactctt |
Secondary structure (Cloverleaf model) | >WENV170013230 Ala GGC t ACCA aaccactctt G - C G - C G + T G - C C - G C - G T - A C T T T C C T C A C G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |