| Sequence ID | >WENV170013231 |
| Genome ID | ATLU01000817 |
| Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
| Species | |
| Start position on genome | 2241 |
| End posion on genome | 2166 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
atatttcttt |
| tRNA gene sequence |
GCACGAGTAGCTCAGTTGGAAGAGCAGCGCCCTTCTAAGGCGAAGGTCACAGGTTCGAGC |
| Downstream region at tRNA end position |
tttcttcgtt |
| Secondary structure (Cloverleaf model) | >WENV170013231 Arg TCT
t ACCA tttcttcgtt
G + T
C - G
A - T
C - G
G - C
A - T
G - C C G
T T G T C C A
T G A A | | | | | G
T C T C G A C A G G C
G | | | | T T
G G A G C
A A A AGGTC
G A
C - G
G - C
C - G
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |