Sequence ID | >WENV170013236 |
Genome ID | ATLU01000968 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2011 |
End posion on genome | 2088 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ccagccatgt |
tRNA gene sequence |
GGGGGTGTAGCTTAGCCAGGCCTAAAGCTCCGGTCTCCAAAACCGGGATCCGCGGTTCGA |
Downstream region at tRNA end position |
cctcattctg |
Secondary structure (Cloverleaf model) | >WENV170013236 Trp CCA t GCCA cctcattctg G + T G - C G + T G - C G - C T - A G - C T A T G C G C C A C C G A A | | | | | G A T T C G C G C G G C G | | | | T T G A A G C C C T A T GATC C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |