Sequence ID | >WENV170013237 |
Genome ID | ATLU01000992 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2357 |
End posion on genome | 2282 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ggattttttt |
tRNA gene sequence |
GCCACTATAGCTCAGCTGGTAGAGCGTTCCCATGGTAAGGGAGAGGTCATGGGTTCAAAT |
Downstream region at tRNA end position |
tttttcaaat |
Secondary structure (Cloverleaf model) | >WENV170013237 Thr GGT t TCCA tttttcaaat G - C C - G C - G A - T C - G T - A A - T T A T T A C C C A C G A A | | | | | A T C T C G A T G G G C G | | | | T T G G A G C T A G AGGTC T + G T - A C - G C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |