Sequence ID | >WENV170013241 |
Genome ID | ATLU01001039 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1221 |
End posion on genome | 1137 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tctgaatttt |
tRNA gene sequence |
GGGCAGTTACCAGAGCGGTCAAATGGGGGGGACTGTAAATCCCCTGGCTACGCCTTCGGG |
Downstream region at tRNA end position |
atttttgtct |
Secondary structure (Cloverleaf model) | >WENV170013241 Tyr GTA t ACCA atttttgtct G - C G - C G - C C - G A - T G - C T - A T A T C T C C C A C G A A | + | | | G G G A C C G G G G G C G | | | T T T A T G G C A A G TGGCTACGCCTTC G - C G - C G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |