Sequence ID | >WENV170013243 |
Genome ID | ATLU01001133 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 57 |
End posion on genome | 134 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccaaattcac |
tRNA gene sequence |
GGCGCTGTAGCTCAGTTGGTAGAGCGGGTCCCTCATAAGGATTGTCAGCCGAAGGTTCGA |
Downstream region at tRNA end position |
agacaatgcg |
Secondary structure (Cloverleaf model) | >WENV170013243 Met CAT c ACCA agacaatgcg G - C G - C C - G G - C C - G T - A G - C C T T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A G GTCAGCC G + T G + T T - A C - G C - G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |