| Sequence ID | >WENV170013244 |
| Genome ID | ATLU01001133 |
| Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
| Species | |
| Start position on genome | 231 |
| End posion on genome | 304 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
accaaacaat |
| tRNA gene sequence |
GACGTGGTGGCGGAATGGTTACGCGCAGGATTGCAAATCCTGTTATCCGGGTTCGACCCC |
| Downstream region at tRNA end position |
atatcggttc |
| Secondary structure (Cloverleaf model) | >WENV170013244 Cys GCA
t TCCA atatcggttc
G - C
A - T
C - G
G - C
T - A
G - C
G + T C C
T G G C C C A
A A G | | | | | G
T G G C G C C G G G C
G | | | T T
G A C G C
T T G TTAT
C - G
A - T
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |