Sequence ID | >WENV170013244 |
Genome ID | ATLU01001133 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 231 |
End posion on genome | 304 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
accaaacaat |
tRNA gene sequence |
GACGTGGTGGCGGAATGGTTACGCGCAGGATTGCAAATCCTGTTATCCGGGTTCGACCCC |
Downstream region at tRNA end position |
atatcggttc |
Secondary structure (Cloverleaf model) | >WENV170013244 Cys GCA t TCCA atatcggttc G - C A - T C - G G - C T - A G - C G + T C C T G G C C C A A A G | | | | | G T G G C G C C G G G C G | | | T T G A C G C T T G TTAT C - G A - T G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |