Sequence ID | >WENV170013245 |
Genome ID | ATLU01001133 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1365 |
End posion on genome | 1441 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccaacctaat |
tRNA gene sequence |
CAGGATATAGCTCAGTCTGGTAGAGTGCTCCCCTCGGAAGGGAGAGGCCGCTGGTTCGAA |
Downstream region at tRNA end position |
atcagcgaga |
Secondary structure (Cloverleaf model) | >WENV170013245 Pro CGG t ACCA atcagcgaga C - G A - T G - C G - C A - T T - A A - T T A T T G A C C A T G A A + | | | | G C C T C G G C T G G C T | | | + T T G G A G T G T A G AGGCC C - G T - A C - G C - G C - G C A T A C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |