Sequence ID | >WENV170013246 |
Genome ID | ATLU01001133 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2078 |
End posion on genome | 2152 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tcttgtggaa |
tRNA gene sequence |
AACACTGTTAGCTCAGTTGGTAGAGCTTCGGCCTTCATAGCCGATTGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
aaagcaaaag |
Secondary structure (Cloverleaf model) | >WENV170013246 SeC TCA a Gaaa aaagcaaaag A - T A A C C A - T C - G T - A G - C T - A T A T C G T C C A T G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C T A T TTGTC T - A C - G G - C G - C C - G C A T T T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |