Sequence ID | >WENV170013251 |
Genome ID | ATLU01001225 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1663 |
End posion on genome | 1739 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tgcaccatat |
tRNA gene sequence |
GCACCCATAGCTCAATTGGATAGAGTACCGGTCTTCGAAGCCGTTGGTTATAGGTTCGAC |
Downstream region at tRNA end position |
taagtttctc |
Secondary structure (Cloverleaf model) | >WENV170013251 Arg TCG t ACCA taagtttctc G - C C - G A - T C - G C - G C - G A - T T C T T A T C C A T A A A | | | | | G T C T C G A T A G G C G | | | + T T G G A G T A T A A TGGTT C T C - G G - C G - C T + G C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |