Sequence ID | >WENV170013254 |
Genome ID | ATLU01001307 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 205 |
End posion on genome | 115 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
attgttttct |
tRNA gene sequence |
GGAAAGGTGCCAGAGTGGTCGAATGGGCTCCCCTGCTAAGGGAGTGAACCGTTATTCGGT |
Downstream region at tRNA end position |
gttttaagtt |
Secondary structure (Cloverleaf model) | >WENV170013254 Ser GCT t GCCA gttttaagtt G - C G - C A - T A - T A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G A C C C A G G G C G | | | T T T A T G G C G A G TGAACCGTTATTCGGTTCC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |