Sequence ID | >WENV170013259 |
Genome ID | ATLU01001368 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 268 |
End posion on genome | 187 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caccaatcac |
tRNA gene sequence |
GCGTTTGTGGCGGAATGGTATACGCAGCAGTTTCAAAAACTGTGGCTACGGCATGTGGGT |
Downstream region at tRNA end position |
atacggatgg |
Secondary structure (Cloverleaf model) | >WENV170013259 Leu CAA c ACCA atacggatgg G - C C - G G - C T - A T + G T - A G - C T C T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C A T A GGCTACGGCAT G + T C - G A - T G - C T - A T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |