Sequence ID | >WENV170013265 |
Genome ID | ATLU01001483 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1953 |
End posion on genome | 1879 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccagcaccac |
tRNA gene sequence |
GCCCCCAAAGCATAGATGGCGATGCACCGGTCTTGTAAGCCGGAAAGCTCTGTTCAAGTC |
Downstream region at tRNA end position |
attcaacagg |
Secondary structure (Cloverleaf model) | >WENV170013265 Thr TGT c ACCA attcaacagg G - C C - G C - G C - G C - G C - G A - T T G A G A G A C A A G A A | | | | | A T T A C G C T C T G C G | | | | T T G A T G C C G A AAAG C - G C - G G - C G - C T + G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |