Sequence ID | >WENV170013266 |
Genome ID | ATLU01001483 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1872 |
End posion on genome | 1797 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
accaattcaa |
tRNA gene sequence |
CAGGATGTAGCTCAGTTGGTAGAGTGTCGGTCTGGGAGACCGAAAGTCGCTGGTTCAAGT |
Downstream region at tRNA end position |
ttaaatcgtt |
Secondary structure (Cloverleaf model) | >WENV170013266 Pro GGG a ACCA ttaaatcgtt C - G A - T G - C G - C A - T T - A G - C T G T T G A C C A T G A A + | | | | A T C T C G G C T G G C G | | | + T T G G A G T T A G AAGTC T - A C - G G - C G - C T - A C G T A G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |