Sequence ID | >WENV170013269 |
Genome ID | ATLU01001574 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 5 |
End posion on genome | 81 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnnatat |
tRNA gene sequence |
GTCACTATAGCTCAGTTGGTTAGAGCGCGGGATTCATATCCCCGAGGTCGGTGGTTCAAA |
Downstream region at tRNA end position |
ttaaaaaata |
Secondary structure (Cloverleaf model) | >WENV170013269 Met CAT t ACCA ttaaaaaata G - C T - A C - G A - T C - G T - A A - T T A T C C A C C A T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C G - C G - C A C T T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |