Sequence ID | >WENV170013271 |
Genome ID | ATLU01001675 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 837 |
End posion on genome | 920 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaaatagtat |
tRNA gene sequence |
GCCCAGGTGGTGAAATGGTAGACACGAGGGATTCAAAATCCCTTTCCTTCGGGAGTGAGG |
Downstream region at tRNA end position |
aattaaattt |
Secondary structure (Cloverleaf model) | >WENV170013271 Leu CAA t ACCA aattaaattt G + T C - G C - G C - G A - T G - C G + T C G T C T C C C A T A A G | | | | | G G A G T G G A G G G C G | | | T T T A C A C A G G TTCCTTCGGGAGT A - T G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |