Sequence ID | >WENV170013275 |
Genome ID | ATLU01002077 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 262 |
End posion on genome | 336 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atctctatcc |
tRNA gene sequence |
GTCCTCATAGTTCAATGGATAGAACAAGCCCCTCCTAAGGGTTAGATGTTGGTTCGATTC |
Downstream region at tRNA end position |
tgtaataatt |
Secondary structure (Cloverleaf model) | >WENV170013275 Arg CCT c ACCA tgtaataatt G + T T - A C - G C - G T + G C - G A - T T T T C G A C C A T A A A | + | | | G G C T T G G T T G G C G | | | | T T A G A A C T A A AGAT A - T G + T C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |