Sequence ID | >WENV170013278 |
Genome ID | ATLU01002258 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 985 |
End posion on genome | 909 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tgaattttca |
tRNA gene sequence |
GGTCCTGTAGTGTAGCGGTTTAACATGCCAGTCTGTCACACTGGAGATCGCGGGTTCAAA |
Downstream region at tRNA end position |
ttaaatgcgc |
Secondary structure (Cloverleaf model) | >WENV170013278 Asp GTC a GCCA ttaaatgcgc G - C G - C T - A C - G C - G T - A G - C T A T T G C C C A C G A A + | | | | A G T G T G G C G G G C G | | | + T T T A C A T T T A G AGATC C - G C - G A - T G - C T - A C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |